Prkd1^{em2(IMPC)Wtsi}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Prkd1^{em2(IMPC)Wtsi}
• Name: protein kinase D1; endonuclease-mediated mutation 2, Wellcome Trust Sanger Institute
• MGI ID: MGI:6153770
• Gene: Prkd1 Location: Chr12:50388014-50695881 bp, - strand Genetic Position: Chr12, 21.78 cM, cytoband C1
• Alliance: Prkd1^{em2(IMPC)Wtsi} page
• IMPC: Prkd1 gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Single point mutation
• Mutation details: This allele from IMPC was generated at Welcome Trust Sanger Institute by injecting CAS9 RNA, the guide sequence CCGGAACCCAGAACTTCATCAGG, and a donor oligo, which resulted in a Point Mutation allele. (J:237616)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Prkd1 Mutation: 57 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)