Spatc1l^em1(IMPC)H
Endonuclease-mediated Allele Detail

Summary

• Symbol: Spatc1l^em1(IMPC)H
• Name: spermatogenesis and centriole associated 1 like; endonuclease-mediated mutation 1, Harwell
• MGI ID: MGI:6153862
• Gene: Spatc1l Location: Chr10:76398106-76406035 bp, + strand Genetic Position: Chr10, 39.2 cM
• Alliance: Spatc1l^em1(IMPC)H page
• IMPC: Spatc1l gene page

Mutation origin

• Strain of Origin: C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA and the guide sequence CCAGCTACCGACATCCTCTCTGG, which resulted in a Indel. (J:237616)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Spatc1l Mutation: 17 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)