Eps15l1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Eps15l1^em1(IMPC)J
• Name: epidermal growth factor receptor pathway substrate 15-like 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6153979
• Gene: Eps15l1 Location: Chr8:73094843-73175304 bp, - strand Genetic Position: Chr8, 35.02 cM, cytoband C1
• Alliance: Eps15l1^em1(IMPC)J page
• IMPC: Eps15l1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences CCTCCCTGTATACTGTCACCTGG and CCCAGTCTCAGCTCTGCTTATAC, which resulted in a 302 bp deletion beginning at Chromosome 8 position 72,384,676 bp and ending after 72,384,977 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000456357 (exon 10) and 158 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 262 and early truncation 3 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Eps15l1 Mutation: 80 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)