Ier3ip1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ier3ip1^em1(IMPC)J
• Name: immediate early response 3 interacting protein 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6154001
• Gene: Ier3ip1 Location: Chr18:77017723-77029310 bp, + strand Genetic Position: Chr18, 51.98 cM
• Alliance: Ier3ip1^em1(IMPC)J page
• IMPC: Ier3ip1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTATACTTAATATCTTCACAGGG, TCAGTCTTCAGGGCTGTCAGCGG, CCATCTTTACTGAACTGAACACC and CCTTGCGTAACTTTTAAGTTACT, which resulted in a 2581 bp deletion beginning at Chromosome 18 position 76,939,313 bp and ending after 76,941,893 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001271873 and ENSMUSE00001293257 (exons 2 and 3) and 1386 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 30 and early truncation 11 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ier3ip1 Mutation: 14 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)