About   Help   FAQ
S2bpcox16em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: S2bpcox16em1(IMPC)J
Name: synaptojanin 2 binding protein Cox16 readthrough; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6154052
Gene: S2bpcox16  Location: Chr12:81405634-81579679 bp, - strand  Genetic Position: Chr12, 37.6 cM
Alliance: S2bpcox16em1(IMPC)J page
IMPC: S2bpcox16 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences ATGGAATCAGATGTGGTCTAGGG and CCAGGCAGTACTACAGGTACTGT, which resulted in a 391 bp deletion beginning at Chromosome 12 position 81,510,784 bp and ending after 81,511,174 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001300363 (exon 2) and 254 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 22 and early truncation 18 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any S2bpcox16 Mutation:  5 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
11/12/2024
MGI 6.24
The Jackson Laboratory