Aifm3^{em1(IMPC)Rbrc}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Aifm3^{em1(IMPC)Rbrc}
• Name: apoptosis-inducing factor, mitochondrion-associated 3; endonuclease-mediated mutation 1, RIKEN BioResource Center
• MGI ID: MGI:6156121
• Gene: Aifm3 Location: Chr16:17307475-17325349 bp, + strand Genetic Position: Chr16, 10.84 cM
• Alliance: Aifm3^{em1(IMPC)Rbrc} page
• IMPC: Aifm3 gene page

Mutation origin

• Strain of Origin: C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Insertion
• Mutation details: This allele from IMPC was generated at RIKEN BioResource Center by injecting CAS9 RNA and 2 guide sequences CCTCCTAAGTCGGGATCACAGGT, AGACAAGTGAATGGCCGCGTGGG, which resulted in a Exon Deletion. (J:237616)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Aifm3 Mutation: 21 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)