Trf^{em1(IMPC)Rbrc}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Trf^{em1(IMPC)Rbrc}
• Name: transferrin; endonuclease-mediated mutation 1, RIKEN BioResource Center
• MGI ID: MGI:6156165
• Gene: Trf Location: Chr9:103086075-103107485 bp, - strand Genetic Position: Chr9, 55.03 cM, cytoband F1-F3
• Alliance: Trf^{em1(IMPC)Rbrc} page
• IMPC: Trf gene page

Mutation origin

• Strain of Origin: C57BL/6NJcl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at RIKEN BioResource Center by injecting CAS9 RNA, 2 guide sequences CCTCCCGGGGACACAAGCAGTAC, GTGAGGCACTCGGGGTATGTAGG, and a non-contributing oligo, which resulted in a Exon Deletion. (J:237616)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Trf Mutation: 42 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)