Aimp1^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Aimp1^em1(IMPC)Tcp
• Name: aminoacyl tRNA synthetase complex-interacting multifunctional protein 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156422
• Gene: Aimp1 Location: Chr3:132366242-132390131 bp, - strand Genetic Position: Chr3, 61.48 cM, cytoband H2
• Alliance: Aimp1^em1(IMPC)Tcp page
• IMPC: Aimp1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0944 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with four single guide RNAs having spacer sequences of GACCTTAGTACTTGTTTAAA and CACCCATGTTAAACTAAAAG targeting the 5' side and CATGCGCAGATCCCGTTAAG and TAGTTAGGGAGCGCGAGTGA targeting the 3' side of exon ENSMUSE00001354960, ENSMUSE00001356626, ENSMUSE00001346722, ENSMUSE00000175327 and ENSMUSE00000175325 resulting a 2,421-bp deletion Chr3:132671874 to 132674294 (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Aimp1 Mutation: 37 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)