Foxr1^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Foxr1^em1(IMPC)Tcp
• Name: forkhead box R1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156427
• Gene: Foxr1 Location: Chr9:44345531-44352165 bp, - strand Genetic Position: Chr9, 24.84 cM, cytoband B
• Alliance: Foxr1^em1(IMPC)Tcp page
• IMPC: Foxr1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0944 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNA(s) having spacer sequences of GGCCAAGCCCGGGTAGTATG and TCCACTGTTACCCCATGATC targeting the 5' side and CCGCAAGCCATCAGCCCAGA and TGAGTGCCAAGGCAATCAGA targeting the 3' side leading to the a 976-bp deletion from Chr9:44435486 to 44436461 (GRCm38). (J:237616)

Expression

In Mice Carrying this Mutation:	4 assay results
In Structures Affected by this Mutation:	5 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Foxr1 Mutation: 9 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 4 reference(s)