Mical2^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mical2^em1(IMPC)Tcp
• Name: microtubule associated monooxygenase, calponin and LIM domain containing 2; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156431
• Gene: Mical2 Location: Chr7:111825063-112012313 bp, + strand Genetic Position: Chr7, 58.75 cM, cytoband F2
• Alliance: Mical2^em1(IMPC)Tcp page
• IMPC: Mical2 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Toronto Centre for Phenogenomics by injecting CAS9 RNA and 4 guide sequences GGTTACTCAACCTTCCTAATTGG, CCAGCAAGTTCTAGCCCCTTGGG, AAAGTGTGAAACGTTGGTACTGG, AGATGGCTCGGCTGGTCTCAAGG, which resulted in a Exon Deletion. (J:237616)

Expression

In Structures Affected by this Mutation:

7 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Mical2 Mutation: 59 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 2 reference(s)