Rttn^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rttn^em1(IMPC)Tcp
• Name: rotatin; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156434
• Gene: Rttn Location: Chr18:88989914-89149140 bp, + strand Genetic Position: Chr18, 58.93 cM
• Alliance: Rttn^em1(IMPC)Tcp page
• IMPC: Rttn gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0563 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of TAGAAGAGATCCTATGAGAC and GCTATACTCTAGAGAAAGAC targeting the 5' side and ACTACAAACAATCATCCGGA and GGTATTATCCAATGGGGTAG targeting the 3' side of exons ENSMUSE00000385993 and ENSMUSE00000365998, resulting in a 2,002 bp deletion of Chr18 from 88973127 to 88975128_insT. (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

5 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Rttn Mutation: 99 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)