Sacs^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Sacs^em1(IMPC)Tcp
• Name: sacsin; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156435
• Gene: Sacs Location: Chr14:61375906-61478144 bp, + strand Genetic Position: Chr14, 32.13 cM
• Alliance: Sacs^em1(IMPC)Tcp page
• IMPC: Sacs gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0556 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of AAGAAATAAGTTGCCCTCAT and ATACCTGATTGGATCAAGAT targeting the 5' side and CCAGTTGGTAGTATCCTTAG and CTTGCTCCCACTCTGAAGTG targeting the 3' side of exons ENSMUSE00000558006, ENSMUSE00000558005 and ENSMUSE00000558003. This resulted in a 6,799-bp deletion of Chr14 from 61178484 to 61185282 (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Sacs Mutation: 156 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)