Aass^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Aass^em1(IMPC)Tcp
• Name: aminoadipate-semialdehyde synthase; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156438
• Gene: Aass Location: Chr6:23072172-23132985 bp, - strand Genetic Position: Chr6, 10.27 cM
• Alliance: Aass^em1(IMPC)Tcp page
• IMPC: Aass gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with four single guide RNAs having spacer sequences of GATGAGGACCTAGGTGGGTG and GCTTCCTTAGGATACTAAGC targeting the 5' side and GTAACTCCACCTATCCTTTC and GAATGAGTGACCATTCAATA targeting the 3' side of exon ENSMUSE00000325812 and ENSMUSE00001242969 resulting in a 473-bp deletion Chr6:23114817-23115289_insGCATCAAGTGTTT (GRCm39). (J:237616)

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Aass Mutation: 59 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 4 reference(s)