Adamtsl3^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Adamtsl3^em1(IMPC)Tcp
• Name: ADAMTS-like 3; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156440
• Gene: Adamtsl3 Location: Chr7:81984902-82263658 bp, + strand Genetic Position: Chr7, 47.18 cM
• Alliance: Adamtsl3^em1(IMPC)Tcp page
• IMPC: Adamtsl3 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0837 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with 4 single guide RNAs with spacer sequences of CACTTTAATCTAAGGCAAGA and GATTGCTGTAGGGCCATTGC targeting the 5' side and GTGATACCTACAGCATTCGG and GGTAGGACTTGTCTAAACAC targeting the 3' side of exon ENSMUSE00000591449 resulting in a 311-bp deletion of Chr7:82575904 to 82576214 (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

7 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Adamtsl3 Mutation: 90 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)