Zfp91^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfp91^em1(IMPC)Tcp
• Name: zinc finger protein 91; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156443
• Gene: Zfp91 Location: Chr19:12744384-12773490 bp, - strand Genetic Position: Chr19, 8.73 cM
• Alliance: Zfp91^em1(IMPC)Tcp page
• IMPC: Zfp91 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0787 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with four guide RNAs having spacer sequences of GCTATGAGTGTACCCTTGCT and AAAATTGGCATAGCCCCCAT targeting the 5' side and TCAAGCATACCTTTCAAGGT and GGTTTAATAGATCAAATGGA targeting the 3' side of exons ENSMUSE00001230146, ENSMUSE00001252442, and ENSMUSE00001304574 (exons 3-5). This resulted in a 1,493-bp deletion of Chr19 from 12777780 to 12779272 (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zfp91 Mutation: 97 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)