Gpcpd1^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gpcpd1^em1(IMPC)Tcp
• Name: glycerophosphocholine phosphodiesterase 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156444
• Gene: Gpcpd1 Location: Chr2:132371002-132420173 bp, - strand Genetic Position: Chr2, 64.57 cM, cytoband F3
• Alliance: Gpcpd1^em1(IMPC)Tcp page
• IMPC: Gpcpd1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1034 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of ATAATAAATCGGAGCGAGCA targeting the 5' side and GATATGTAGCCCAAACTTGG targeting the 3' side of a critical exon. This resulted in a 595-bp deletion Chr2:132546771 to 132547365_insGGGATTCC.(GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Gpcpd1 Mutation: 32 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)