Cox6b1^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cox6b1^em1(IMPC)Tcp
• Name: cytochrome c oxidase, subunit 6B1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156449
• Gene: Cox6b1 Location: Chr7:30316396-30325539 bp, - strand Genetic Position: Chr7, 18.84 cM, cytoband A3
• Alliance: Cox6b1^em1(IMPC)Tcp page
• IMPC: Cox6b1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0671 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of GAGCTATATACGCCTGACCT and GTGCTTAGTCGGGGTTGATT targeting the 5' side and GACCACCCAAGGGTCCCGTC and TCACCTCCAAGGGTCAAGCG targeting the 3' side of exon ENSMUSE00000516175. This resulted in a 283-bp deletion of Chr7 from 30623398 to 30623660 and an indel at Chr7:30623292_insC (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Cox6b1 Mutation: 14 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)