Polr1b^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Polr1b^em1(IMPC)Tcp
• Name: polymerase (RNA) I polypeptide B; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156451
• Gene: Polr1b Location: Chr2:128942915-128968514 bp, + strand Genetic Position: Chr2, 62.68 cM, cytoband F3
• Alliance: Polr1b^em1(IMPC)Tcp page
• IMPC: Polr1b gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0887 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes and single guide RNA(s) with spacer sequences of GGCCGTCCCTTCCAACCAGA and GCCAACAAAGTGCAACCCTC targeting the 5' side and GGACTCGGCTACACTCAGTT and AACATCATAGAAGTGCTTAA targeting the 3' side leading to a 402-bp deletion from Chr2:129104981 to 129105382 (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

5 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Polr1b Mutation: 59 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)