About   Help   FAQ
Polr1bem1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Polr1bem1(IMPC)Tcp
Name: polymerase (RNA) I polypeptide B; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6156451
Gene: Polr1b  Location: Chr2:128942915-128968514 bp, + strand  Genetic Position: Chr2, 62.68 cM, cytoband F3
Alliance: Polr1bem1(IMPC)Tcp page
IMPC: Polr1b gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR0887 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes and single guide RNA(s) with spacer sequences of GGCCGTCCCTTCCAACCAGA and GCCAACAAAGTGCAACCCTC targeting the 5' side and GGACTCGGCTACACTCAGTT and AACATCATAGAAGTGCTTAA targeting the 3' side leading to a 402-bp deletion from Chr2:129104981 to 129105382 (GRCm38). (J:237616)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 5 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Polr1b Mutation:  59 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/10/2024
MGI 6.24
The Jackson Laboratory