Arih1^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Arih1^em1(IMPC)Tcp
• Name: ariadne RBR E3 ubiquitin protein ligase 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156459
• Gene: Arih1 Location: Chr9:59295541-59393901 bp, - strand Genetic Position: Chr9, 32.01 cM, cytoband C
• Alliance: Arih1^em1(IMPC)Tcp page
• IMPC: Arih1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1031 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of ACAGAGGGTGAGTGCACGTA and CTTAGAGGACGTCAGGTTTT targeting the 5' side and GAGTACCTGACTATGTAAGA and TAAATCTACTAACAGGTTAC targeting the 3' side of a critical exon resulting in a 387-bp del Chr9:59436712 to 59437098 (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Arih1 Mutation: 33 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)