Slc30a4^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slc30a4^em1(IMPC)Tcp
• Name: solute carrier family 30 (zinc transporter), member 4; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156460
• Gene: Slc30a4 Location: Chr2:122523153-122544583 bp, - strand Genetic Position: Chr2, 60.65 cM
• Alliance: Slc30a4^em1(IMPC)Tcp page
• IMPC: Slc30a4 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0918 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GGATGGATATGAATTAGTTA and CACTTCATACGAACTAGACA targeting the 5' side and TACTTAGAAGTATAATGAAA and TTAGTGTTAAACTCTGAGAC targeting the 3' side of a critical region. This resulted in a 382-bp del Chr2: 122689235 to 122689616 (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Slc30a4 Mutation: 24 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)