Dlgap1^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dlgap1^em1(IMPC)Tcp
• Name: DLG associated protein 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156461
• Gene: Dlgap1 Location: Chr17:70276068-71128408 bp, + strand Genetic Position: Chr17, 40.85 cM
• Alliance: Dlgap1^em1(IMPC)Tcp page
• IMPC: Dlgap1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0903 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CAGGGTATATGAGCATTAAT and GTCGTGACACCCAGCTTAGA targeting the 5' side and CGTGGCCACGCGCTGTAATC and GTGGGCCACTCGTTCATCCC targeting the 3' side of exon ENSMUSE00001230926. This resulted in a 1794-bp deletion of Chr17 from 70655896 to 70657689 (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Dlgap1 Mutation: 128 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 4 reference(s)