Nelfa^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nelfa^em1(IMPC)Tcp
• Name: negative elongation factor complex member A, Whsc2; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156462
• Gene: Nelfa Location: Chr5:34055263-34093615 bp, - strand Genetic Position: Chr5, 17.83 cM
• Alliance: Nelfa^em1(IMPC)Tcp page
• IMPC: Nelfa gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0950 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TGCATGCAGCTTATGAGCTA and CATCTATCTATTACTAGCAG targeting the 5' side and GCCATGGCATACTACATCAA and TCGAGGTCACACACTCCTAC targeting the 3' side of a critical region. The resulted in a 1098-bp deletion from Chr5:33921362 to 33922459 (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Nelfa Mutation: 35 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)