Bdp1^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Bdp1^em1(IMPC)Tcp
• Name: B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156463
• Gene: Bdp1 Location: Chr13:100154502-100240578 bp, - strand Genetic Position: Chr13, 52.92 cM
• Alliance: Bdp1^em1(IMPC)Tcp page
• IMPC: Bdp1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0880 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GATACATTGGAGAGGTGAAG and GCCAGGCATAATGAAATACA targeting the 5' side and TAAAATGGAACCTGCCACGT and CTGCCAACTATTCACTTAAA targeting the 3' side of exons ENSMUSE00000680067 and ENSMUSE00000680066 resulting in a 2,080-bp deletion Chr13:100092104 to 100094183 and a 12-bp insertion TAGGAATAAATC (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Bdp1 Mutation: 89 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)