Timm8a1^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Timm8a1^em1(IMPC)Tcp
• Name: translocase of inner mitochondrial membrane 8A1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156465
• Gene: Timm8a1 Location: ChrX:133438005-133442419 bp, - strand Genetic Position: ChrX, 56.18 cM
• Alliance: Timm8a1^em1(IMPC)Tcp page
• IMPC: Timm8a1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Toronto Centre for Phenogenomics by injecting CAS9 RNA and 4 guide sequences CCCCGCGAGCGGAATCGGCTCCC, ACGTGTCTGGGTGACGGAACCGG, CCTCTATCAGGGACTTAAGGTGT, CCCAAAATCGGAGTTTGCAGTTA, which resulted in a Exon Deletion. (J:237616)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Timm8a1 Mutation: 6 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)