Usp29^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Usp29^em1(IMPC)Tcp
• Name: ubiquitin specific peptidase 29; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156467
• Gene: Usp29 Location: Chr7:6733577-6970218 bp, + strand Genetic Position: Chr7, 4.04 cM
• Alliance: Usp29^em1(IMPC)Tcp page
• IMPC: Usp29 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0502 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with the spacer sequences TCCTGTTTGTGCTGCGGATC, TGATAATGTTACAGGCGTAG, GATCTGAACTCTCGAACACT, and TAACGGCCTTACATACATCC. This resulted in a 2607 bp deletion of Chr7 from 6961151 to 6963757. This mutation is predicted to cause a frameshift with the amino acid changes after residue 7 and early truncation (p.R7F*fs1). (GRCm38). (J:237616)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Usp29 Mutation: 117 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)