About   Help   FAQ
Usp29em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Usp29em1(IMPC)Tcp
Name: ubiquitin specific peptidase 29; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6156467
Gene: Usp29  Location: Chr7:6733577-6970218 bp, + strand  Genetic Position: Chr7, 4.04 cM
Alliance: Usp29em1(IMPC)Tcp page
IMPC: Usp29 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR0502 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with the spacer sequences TCCTGTTTGTGCTGCGGATC, TGATAATGTTACAGGCGTAG, GATCTGAACTCTCGAACACT, and TAACGGCCTTACATACATCC. This resulted in a 2607 bp deletion of Chr7 from 6961151 to 6963757. This mutation is predicted to cause a frameshift with the amino acid changes after residue 7 and early truncation (p.R7F*fs1). (GRCm38). (J:237616)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Usp29 Mutation:  117 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory