Trim13^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Trim13^em1(IMPC)Tcp
• Name: tripartite motif-containing 13; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156472
• Gene: Trim13 Location: Chr14:61835696-61843395 bp, + strand Genetic Position: Chr14, 33.16 cM
• Alliance: Trim13^em1(IMPC)Tcp page
• IMPC: Trim13 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1020 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GGAATGTGCGGAATTCCCTG targeting the 5' side and AGTTATGCAAACCTATGACC targeting the 3' side of a critical exon. This resulted in a 511-bp deletion Chr14:61604671 to 61605181; p.L46Tfs*45 resulting in a frameshift mutation in all annotated full length protein-coding transcripts (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

8 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Trim13 Mutation: 56 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)