Tanc1^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tanc1^em1(IMPC)Tcp
• Name: tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156475
• Gene: Tanc1 Location: Chr2:59442386-59676493 bp, + strand Genetic Position: Chr2, 33.93 cM
• Alliance: Tanc1^em1(IMPC)Tcp page
• IMPC: Tanc1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0867 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of ACGGAGTGCGTCTCCCTGAA and ATTATAGAAACATGGTCCCC targeting the 5' side and CCTAAGGGGACCTAATGCAA and TTTCCCGCCTGATGACCTAT targeting the 3' side of a critical region. This resulted in a 1,227-bp deletion from Chr2:59771703 to 59772929 (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tanc1 Mutation: 405 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)