H2bc4^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: H2bc4^em1(IMPC)Tcp
• Name: H2B clustered histone 4; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156478
• Gene: H2bc4 Location: Chr13:23868182-23876805 bp, + strand Genetic Position: Chr13, 9.87 cM, cytoband A2-A3
• Alliance: H2bc4^em1(IMPC)Tcp page
• IMPC: H2bc4 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Toronto Centre for Phenogenomics by injecting CAS9 Protein and 2 guide sequences CCGAAGATGCCTGAGCCTGCGAA, CCTGCCAAGTAAGCCTCCGTAGC, which resulted in a Exon Deletion. (J:237616)

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any H2bc4 Mutation: 8 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)