About   Help   FAQ
Pak1ip1em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Pak1ip1em1(IMPC)Tcp
Name: PAK1 interacting protein 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6156479
Gene: Pak1ip1  Location: Chr13:41154499-41166491 bp, + strand  Genetic Position: Chr13, 20.23 cM
Alliance: Pak1ip1em1(IMPC)Tcp page
IMPC: Pak1ip1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR0848 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CGAAGGTTCTGAAGTGATCA and TCACTACTAATGCCGAGCGG targeting the 5' side and ACTTCGGCTCTACACGGAAA and CGAAACGATCTGTACTGACC targeting the 3' side of a critical region. This resulted in a 927-bp deletion Chr13: 41007478 to 41008404 (GRCm38). (J:237616)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Pak1ip1 Mutation:  28 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
11/12/2024
MGI 6.24
The Jackson Laboratory