Pak1ip1^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pak1ip1^em1(IMPC)Tcp
• Name: PAK1 interacting protein 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156479
• Gene: Pak1ip1 Location: Chr13:41154499-41166491 bp, + strand Genetic Position: Chr13, 20.23 cM
• Alliance: Pak1ip1^em1(IMPC)Tcp page
• IMPC: Pak1ip1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0848 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CGAAGGTTCTGAAGTGATCA and TCACTACTAATGCCGAGCGG targeting the 5' side and ACTTCGGCTCTACACGGAAA and CGAAACGATCTGTACTGACC targeting the 3' side of a critical region. This resulted in a 927-bp deletion Chr13: 41007478 to 41008404 (GRCm38). (J:237616)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Pak1ip1 Mutation: 28 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)