About   Help   FAQ
Pwwp3aem1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Pwwp3aem1(IMPC)Tcp
Name: PWWP domain containing 3A, DNA repair factor; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6156480
Gene: Pwwp3a  Location: Chr10:80062268-80079737 bp, + strand  Genetic Position: Chr10, 39.72 cM
Alliance: Pwwp3aem1(IMPC)Tcp page
IMPC: Pwwp3a gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR0733 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of ACAGACGCTGCCAAGGGAAC and GATCCTGCGACAACAATGAG targeting the 5' side and TTCACGCTGTGGGTTCGGGT and AAATCATACCTTAGGAGGGT targeting the 3' side resulting in a 3101-bp deletion of Chr10 from 80230041 to 80233141 (GRCm38). (J:237616)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Pwwp3a Mutation:  31 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/22/2024
MGI 6.24
The Jackson Laboratory