Prdm5^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Prdm5^em1(IMPC)Tcp
• Name: PR domain containing 5; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156485
• Gene: Prdm5 Location: Chr6:65755972-65913994 bp, + strand Genetic Position: Chr6, 30.32 cM, cytoband C1
• Alliance: Prdm5^em1(IMPC)Tcp page
• IMPC: Prdm5 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele from project TCPR0487 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with spacer sequences CGAAGCCAGTTGGAGTGTCT and TGTTCACGAGGCACCATCTC. This resulted in a 7 bp deletion in Chr6:65831328-65831334_ACGAGGC (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Prdm5 Mutation: 48 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)