Cpvl^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cpvl^em1(IMPC)Tcp
• Name: carboxypeptidase, vitellogenic-like; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156486
• Gene: Cpvl Location: Chr6:53850264-53955656 bp, - strand Genetic Position: Chr6, 26.19 cM, cytoband B3
• Alliance: Cpvl^em1(IMPC)Tcp page
• IMPC: Cpvl gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Insertion
• Mutation details: This allele from project TCPR0780 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TGGCTATAGTATCGCTGTGT and GGTTGAGCTCCTAACAAAAT targeting the 5' side and ATGTAGCCCAAGACTTGTAC and GCTACAACTGGTTACATTCA targeting the 3' side of exon ENSMUSE00000444358 and ENSMUSE00000444356. This resuled in a 1431-bp deletion of Chr6 from 53952328 to 53953758 with an insertion of ACCAGT (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Cpvl Mutation: 28 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)