Syce2^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Syce2^em1(IMPC)Tcp
• Name: synaptonemal complex central element protein 2; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156487
• Gene: Syce2 Location: Chr8:85598740-85614075 bp, + strand Genetic Position: Chr8, 41.25 cM
• Alliance: Syce2^em1(IMPC)Tcp page
• IMPC: Syce2 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0979 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GGCACTAAAGTAGAGATATA targeting the 5' side and CTGATAAGTACTCGTAATAC targeting the 3' side leading to a 1261-bp del Chr8:84883414 to 84884674 (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

6 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Syce2 Mutation: 16 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)