Rnf135^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rnf135^em1(IMPC)Tcp
• Name: ring finger protein 135; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156488
• Gene: Rnf135 Location: Chr11:80074677-80090583 bp, + strand Genetic Position: Chr11, 47.59 cM, cytoband B5
• Alliance: Rnf135^em1(IMPC)Tcp page
• IMPC: Rnf135 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0621 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of TTCTGACTTGTGTACTCAGG and TTGGAACAGGGCTCACACGT targeting the 5' side and GGCCATTCCCACCCAATCAG and TGATCCCTAATCCTAGTTTA targeting the 3' side of ENSMUSG00000020707. This resulted in a 2,455-bp deletion of Chr11 from 80192713 to 80195167 (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

5 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Rnf135 Mutation: 41 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)