About   Help   FAQ
Tagap1em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Tagap1em1(IMPC)Tcp
Name: T cell activation GTPase activating protein 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6156489
Gene: Tagap1  Location: Chr17:7222410-7228555 bp, - strand  Genetic Position: Chr17, 4.55 cM, cytoband A1
Alliance: Tagap1em1(IMPC)Tcp page
IMPC: Tagap1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR0851 was generated at The Centre for Phenogenomics by electroporating Cas9 ribnucleoprotein complexes with two guide RNAs having spacer sequences of GGCGTGCTGAACCGCATCAA targeting the 5' side and TGACAGAATGCATTTCCACC targeting the 3' side of exons ENSMUSE00000658353, ENSMUSE00001018647, ENSMUSE00000975105, and ENSMUSE00000455244 resulting in a 5,812-bp deletion of Chr17 from 6955239 to 6961050 (GRCm38). This mutation is predicted to cause a frameshift with the amino acid changes after residue 26 and early truncation 3 amino acids later (p.N26Kfs*5). (J:237616)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 4 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Tagap1 Mutation:  19 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/10/2024
MGI 6.24
The Jackson Laboratory