Wdr62^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Wdr62^em1(IMPC)Tcp
• Name: WD repeat domain 62; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156494
• Gene: Wdr62 Location: Chr7:29939563-29979844 bp, - strand Genetic Position: Chr7, 17.34 cM
• Alliance: Wdr62^em1(IMPC)Tcp page
• IMPC: Wdr62 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0452 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of CTATCTTACGTGACAGAATG and TAGCATCGCCTCTAACCGCA targeting the 5' side and GCCCCTCCCAGTTGAAGTCC and CCGAAGTCATAGTAGCTACC targeting the 3' side of exon ENSMUSE00000343496 (exon 11). This resulted in a 849 bp deletion of Chr7 from 30261130 to 30261978. (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

6 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Wdr62 Mutation: 52 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)