Hyls1^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Hyls1^em1(IMPC)Tcp
• Name: HYLS1, centriolar and ciliogenesis associated; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156495
• Gene: Hyls1 Location: Chr9:35472117-35481365 bp, - strand Genetic Position: Chr9, 20.32 cM
• Alliance: Hyls1^em1(IMPC)Tcp page
• IMPC: Hyls1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0683 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and three guide RNAs with spacer sequences of GCAGCTAACATTCGTTCTTC and CTTTACTGTAGGGATCATAC targeting the 5' side and ACAACGCACACCCCACCGAA targeting the 3' side of exon ENSMUSE00000701722 resulting in a 685-bp deletion of Chr9 from 35561247 to 35561931 (gRNA_U3 to gRNA_D). This mutation is predicted to cause a frameshift with the amino acid changes after residue 63 and early truncation 38 amino acids later (c.188_872del, p.D63Gfs*40). (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Hyls1 Mutation: 29 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)