Jade2^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Jade2^em1(IMPC)Tcp
• Name: jade family PHD finger 2; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156496
• Gene: Jade2 Location: Chr11:51704282-51748480 bp, - strand Genetic Position: Chr11, 31.5 cM
• Alliance: Jade2^em1(IMPC)Tcp page
• IMPC: Jade2 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0859 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of AGGACGGCTTCGTAGGCCAG and CCGGAAAACCTGCAGACATG targeting the 5' side and CTAGGAACGAATCTCAGAAC and GTTACTTACCCATGAGGCTT targeting the 3' side. This resulted in a 299-bp deletion Chr11:51835490 to 51835788 and Chr11:51835395_delCinsAGTAAGTA (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

5 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Jade2 Mutation: 33 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)