Notum^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Notum^em1(IMPC)Tcp
• Name: notum palmitoleoyl-protein carboxylesterase; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156499
• Gene: Notum Location: Chr11:120544614-120552001 bp, - strand Genetic Position: Chr11, 84.38 cM
• Alliance: Notum^em1(IMPC)Tcp page
• IMPC: Notum gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0445 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of CGCAAAAGGAACGCACAAGC and AGGGCTTGAGGATTCCGGTT targeting the 5' side and CCTGCCCTGTCTTAATGGGC and GTGCAAGAGGCCCTGCTAGG targeting the 3' side of a critical region. This resulted in a 221 bp deletion of Chr11 from 120657737 to 120658957.(GRCm38). (J:237616)

Expression

In Mice Carrying this Mutation:	1 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation:	4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Notum Mutation: 29 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 4 reference(s)