Syt9^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Syt9^em1(IMPC)Tcp
• Name: synaptotagmin IX; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156504
• Gene: Syt9 Location: Chr7:106969935-107147863 bp, + strand Genetic Position: Chr7, 56.33 cM, cytoband F2
• Alliance: Syt9^em1(IMPC)Tcp page
• IMPC: Syt9 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0866 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GAGCTTGTTCATATAAATCT and CGAGGCTTAAAAATGAGGCC targeting the 5' side and TTGACAACCAAGTGCTTGCG and CGTCAACCACTCCCAAGCTC targeting the 3' side of a critical region. This resulted in a 2,241-bp deletion Chr7:107434928 to 107437168 (GRCm38). (J:237616)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Syt9 Mutation: 29 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)