About   Help   FAQ
Ranbp17em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Ranbp17em1(IMPC)Tcp
Name: RAN binding protein 17; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6156506
Gene: Ranbp17  Location: Chr11:33161795-33463746 bp, - strand  Genetic Position: Chr11, 19.21 cM, cytoband A5
Alliance: Ranbp17em1(IMPC)Tcp page
IMPC: Ranbp17 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR0785 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TCCAAGCCTAAGAACACACT and GGGAACAAGGATAGACTTGC targeting the 5' side and GGCTTTCGCTTAGCGCTCCT and AGTCTGCGTCACTAAGTCAC targeting the 3' side of exon ENSMUSE00001152754. This resulted in a 1572-bp deletion Chr11: 33492917 to 33494488 gRNA_U5 to _D3 (GRCm38). (J:237616)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ranbp17 Mutation:  59 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
11/12/2024
MGI 6.24
The Jackson Laboratory