Smpdl3a^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Smpdl3a^em1(IMPC)Tcp
• Name: sphingomyelin phosphodiesterase, acid-like 3A; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156507
• Gene: Smpdl3a Location: Chr10:57670640-57687926 bp, + strand Genetic Position: Chr10, 29.25 cM
• Alliance: Smpdl3a^em1(IMPC)Tcp page
• IMPC: Smpdl3a gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0790 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with four guide RNAs with spacer sequences of GAGAGCTGTGCTTAAACTCG and ACGTGCCAAAACTGCCCTGT targeting the 5' side and CACTGGGCAATCATGACTAC and TGTCAGAGTTATGACAGTGG targeting the 3' side of exons ENSMUSE00000098735, ENSMUSE00000724134, and ENSMUSE00001304146 resulting in a 1750-bp deletion of Chr10 from 57800808 to 57802557 and a 1-bp deletion of Chr10: 57802633 (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Smpdl3a Mutation: 35 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)