Phip^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Phip^em1(IMPC)Tcp
• Name: pleckstrin homology domain interacting protein; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156509
• Gene: Phip Location: Chr9:82748212-82857569 bp, - strand Genetic Position: Chr9, 45.18 cM, cytoband E3.1
• Alliance: Phip^em1(IMPC)Tcp page
• IMPC: Phip gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0832 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TACCACATTATCTTCACAAC and GGATGAAATACTTTCAGGCT targeting the 5' side and ACTATGTTGTGATGTCCTCT and AAGTTACATGTTGAGTTAAT targeting the 3' side of a critical region. This resulted in a 3,149-bp deletion of Chr9 from 82959244 to 82962392 (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Phip Mutation: 113 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)