Tmem121b^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tmem121b^em1(IMPC)Tcp
• Name: transmembrane protein 121B; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156511
• Gene: Tmem121b Location: Chr6:120465900-120470768 bp, - strand Genetic Position: Chr6, 56.95 cM
• Alliance: Tmem121b^em1(IMPC)Tcp page
• IMPC: Tmem121b gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0755 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with four guide RNAs having spacer sequences of GAGAGCGGCCGGGCAGCCCC and CGGGTGCATTGTCCTCGGAG targeting the 5' side and AGGAGCACCATAGCTGCTTC and CATTTTCCAAGTGGCCCCGC targeting the 3' side of a critical region. This resulted in a 1,842-bp deletion of Chr6 from 120492099 to 120493940_insTGAGCTGGGGGAGCGC (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tmem121b Mutation: 18 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)