Phrf1^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Phrf1^em1(IMPC)Tcp
• Name: PHD and ring finger domains 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156548
• Gene: Phrf1 Location: Chr7:140808697-140842663 bp, + strand Genetic Position: Chr7, 86.53 cM
• Alliance: Phrf1^em1(IMPC)Tcp page
• IMPC: Phrf1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1025 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having with spacer sequences of GCCTGAGGACCCCATAACAT and ACATTCCATGTGGTACCTAT targeting the 5' side and CCTGCCATATGACCATGCTA and AGCGTAGGTGAGTCTATTGA targeting the 3' side of a critical region. This resulted in a 826-bp deletion from Chr7:141246719 to 141247544 (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

9 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Phrf1 Mutation: 73 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)