Spred3^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Spred3^em1(IMPC)Tcp
• Name: sprouty-related EVH1 domain containing 3; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156549
• Gene: Spred3 Location: Chr7:28858254-28869836 bp, - strand Genetic Position: Chr7, 16.94 cM, cytoband A3
• Alliance: Spred3^em1(IMPC)Tcp page
• IMPC: Spred3 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0439 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of GTGGGTGTACTGGTGGCTTG and GTTAGGGAGAACGCTCAAAC targeting the 5' side and TATTGAGCTTGAGGTTGGCC and TACTGGTGTGTCACCAGGTG targeting the 3' side of a critical region. This resulted in a 1928 bp deletion & 12bp insTAAAAGGGATAA of Chr7 from 29166134 to 29168061. (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Spred3 Mutation: 15 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)