Edc3^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Edc3^em1(IMPC)Tcp
• Name: enhancer of mRNA decapping 3; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156550
• Gene: Edc3 Location: Chr9:57615823-57659782 bp, + strand Genetic Position: Chr9, 31.37 cM
• Alliance: Edc3^em1(IMPC)Tcp page
• IMPC: Edc3 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0903 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CTATCACTCTACCTTCCCGA and TACCTATTGAAGGAGCGAAT targeting the 5' side and TACAGGAGTTGTGCCGACGA and CCCCGTTACATGAGTAATGA targeting the 3' side of exon ENSMUSE00000751233 and ENSMUSE00000257623. This resulted in a 904-bp deletion of Chr9 from 57715453 to 57716356 with a 4-bp insertion AAGG (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

5 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Edc3 Mutation: 29 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)