About   Help   FAQ
Tedc1em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Tedc1em1(IMPC)Tcp
Name: tubulin epsilon and delta complex 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6156552
Gene: Tedc1  Location: Chr12:113120041-113129668 bp, + strand  Genetic Position: Chr12, 61.62 cM
Alliance: Tedc1em1(IMPC)Tcp page
IMPC: Tedc1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Not Specified)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR0758 was generated at The Centre for Phenogenomics by electroporating Cas9 ribnucleoprotein complexes with four guide RNAs having spacer sequences of CACTACTACCCAGGTAAGCG and GCTAACCTGGAGATTTCACC targeting the 5' side and CTGTTGGGGAAATACCCGGC and GATACGTCAGGTAGAACTAG targeting the 3' side of exons ENSMUSE00000438166, ENSMUSE00000374366 and ENSMUSE00000304458 resulting in a 1125-bp deletion of Chr12 from 113157114 to 113158238 (GRCm38). (J:237616)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 4 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Tedc1 Mutation:  27 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory