Tedc1^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tedc1^em1(IMPC)Tcp
• Name: tubulin epsilon and delta complex 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156552
• Gene: Tedc1 Location: Chr12:113120041-113129668 bp, + strand Genetic Position: Chr12, 61.62 cM
• Alliance: Tedc1^em1(IMPC)Tcp page
• IMPC: Tedc1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0758 was generated at The Centre for Phenogenomics by electroporating Cas9 ribnucleoprotein complexes with four guide RNAs having spacer sequences of CACTACTACCCAGGTAAGCG and GCTAACCTGGAGATTTCACC targeting the 5' side and CTGTTGGGGAAATACCCGGC and GATACGTCAGGTAGAACTAG targeting the 3' side of exons ENSMUSE00000438166, ENSMUSE00000374366 and ENSMUSE00000304458 resulting in a 1125-bp deletion of Chr12 from 113157114 to 113158238 (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tedc1 Mutation: 27 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)