Mkrn3^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mkrn3^em1(IMPC)Tcp
• Name: makorin, ring finger protein, 3; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156558
• Gene: Mkrn3 Location: Chr7:62067341-62069887 bp, - strand Genetic Position: Chr7, 34.37 cM
• Alliance: Mkrn3^em1(IMPC)Tcp page
• IMPC: Mkrn3 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0782 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GCGGCCGCGTGGGCCTCAAT and ATCGGGTCTGGCACCGCTCC targeting the 5' side and TTTCCCTCTCGCAACTGCAC and GAGCCAACGGTCATCAGAGA targeting the 3' side of exon ENSMUSE00000593055 resulting in a 1,548-bp deletion of Chr7 from 62418469 to 62420016 (GRCm38). (J:237616)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Mkrn3 Mutation: 26 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)