Nav2^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nav2^em1(IMPC)Tcp
• Name: neuron navigator 2; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156559
• Gene: Nav2 Location: Chr7:48608796-49259838 bp, + strand Genetic Position: Chr7, 31.23 cM
• Alliance: Nav2^em1(IMPC)Tcp page
• IMPC: Nav2 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0783 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CGGCCCTCCCTTGTCTAAAA and CGTCACCAGAGGCATAAATG targeting the 5' side and GGCGCTGCCGACCCATCTTC and CCAATCAGACCAGTGGCGCT targeting the 3' side of a critical region. This resulted in a 473-bp deletion of Chr7 from 49408477 to 49408949 and a 271-bp deletion of Chr7 from 49409000 to 49409270 (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Nav2 Mutation: 129 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)